Journal: Tissue Engineering and Regenerative Medicine

Article Title: Evaluation of Collagen Gel-Associated Human Nasal Septum-Derived Chondrocytes As a Clinically Applicable Injectable Therapeutic Agent for Cartilage Repair

doi: 10.1007/s13770-020-00261-9

Figure Lengend Snippet: Chondrocyte-specific protein expression of hNC-collagen after collagen encapsulation. A, B Confocal microscopy images of hNC-collagen in PBS in the absence of growth medium and stained with the chondrocyte-specific markers COL2A (red), SOX9 (red), Aggrecan (red). Nuclei were counterstained with DAPI (blue). Scale bars: A 50 μm; B 20 μm. All images are representative of three independent experiments. C–E The number of SOX9-, Aggrecan-, COL2A-positive cells were counted at 1 h, 9 h, and 24 h after collagen encapsulation. The data are presented as the percentage of Sox9-, aggrecan-, type II collagen-positive cells to DAPI (± SEM). Statistical comparisons were made by one-way ANOVA. There was no consistent change in the number of positive cells. The results are representative of two independent experiments. NC; negative control, PC; positive control, Col; collagen only, Mix; hNC-collagen mixture, Cell; cell only

Article Snippet: The membranes were blocked and incubated with primary antibodies against COL2A (1:500; Santa Cruz Biotechnology Inc.), SOX9 (1:500; Abcam, Cambridge, UK), and GAPDH (1:1000; Santa Cruz Biotechnology Inc.) and the appropriate secondary antibodies.

Techniques: Expressing, Encapsulation, Confocal Microscopy, Staining, Negative Control, Positive Control

Journal: aging and disease

Article Title: Enhanced Chondrogenic Potential and Osteoarthritis Treatment Using Cyaonoside A-Induced MSC Delivered via a Hyaluronic Acid-Based Hydrogel System

doi: 10.14336/ad.2024.10016

Figure Lengend Snippet: Figure 8. In vivo therapeutic evaluation of hydrogel loaded with CyA-induced MSC. (A) Representative 3D reconstruction images of joints in different groups. (B) H&E staining of articular cartilage in different groups. (C) S&F staining of articular cartilage in different groups. (D) Immunohistochemical staining of COL2A in articular cartilage across different groups. (E) Immunofluorescence staining of Caspase-3 in articular cartilage across different groups. (F, G) Relative mRNA expression levels of ACAN and COL2A in joint tissues of different groups. Statistical significance was determined using one-way ANOVA for multiple group comparisons, followed by post hoc tests. All data are presented as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, and ns = no statistically significant difference between groups.

Article Snippet: The COL2A primary antibody (1:1000, Cat# 28459-1-AP, Proteintech, USA) was applied, and the sections were incubated overnight at 4°C.

Techniques: In Vivo, Staining, Immunohistochemical staining, Immunofluorescence, Expressing

Journal: iScience

Article Title: Dysregulated lysosomal exocytosis drives protease-mediated cartilage pathogenesis in multiple lysosomal disorders

doi: 10.1016/j.isci.2024.109293

Figure Lengend Snippet:

Article Snippet: Primer: col2a-qRTPCR Forward: gaacttcctcaggctgctgt Reverse: tgtaagccacgctgttcttg , Eton Bioscience Inc (10) , N/A.

Techniques: Recombinant, Protease Inhibitor, SYBR Green Assay, Gel Extraction, TA Cloning, Bicinchoninic Acid Protein Assay, DNA Sequencing, Control, Software